Article Text
PDF
Abstract
Objective The functional 577R allele of the α-actinin-3 (ACTN3) gene has been reported to be associated with elite power athlete status, while the nonfunctional 577XX genotype (predicts an α-actinin-3 deficient phenotype) has been hypothesised as providing some sort of advantage for endurance athletes. In the present study, the distribution of ACTN3 genotypes and alleles in Russian endurance-oriented athletes were examined and association between ACTN3 genotypes and the competition results of rowers were sought.
Methods 456 Russian endurance-oriented athletes of regional or national competitive standard were involved in the study. ACTN3 genotype and allele frequencies were compared with 1211 controls. The data from the Russian Cup Rowing Tournament were used to search for possible association between the ACTN3 genotype and the long-distance (∼6 km) rowing results of 54 athletes. DNA was extracted from mouthwash samples. Genotyping for the R577X variant was performed by PCR and restriction enzyme digestion.
Results The frequencies of the ACTN3 577XX genotype (5.7% vs 14.5%; p<0.0001) and 577X allele (33.2% vs 39.0%; p = 0.0025) were significantly lower in endurance-oriented athletes compared with the controls, and none of the highly elite athletes had the 577XX genotype. Furthermore, male rowers with ACTN3 577RR genotype showed better results (1339 (11) s) in long-distance rowing than carriers of 577RX (1386 (12) s) or 577XX (1402 (10) s) genotypes (p = 0.016).
Conclusion Our data show that the ACTN3 577X allele is under-represented in Russian endurance athletes and is associated with the rowers’ competition results.
Statistics from Altmetric.com
It has long been recognised that the interindividual variability of physical performance traits has a strong genetic basis. The polymorphisms in genes that influence these traits are now being sought. One gene potentially associated with human physical performance is the ACTN3 gene, which encodes the protein α-actinin-3. This protein forms part of the sarcomeric apparatus in the fast glycolytic fibres of human skeletal muscle—the fibres responsible for the generation of rapid, forceful contractions in activities such as sprinting and weightlifting and is thought to perform specialised roles important to the functioning of these fibres.1
A common genetic variation in the ACTN3 gene (C>T transition in exon 16; rs1815739) that results in the replacement of an arginine (R) with a stop codon (X) at amino acid 577 (R577X) had been identified nearly a decade ago.2 This variation creates two different versions of the ACTN3 gene, both of which are common in the general population: the 577R allele is the normal, functional version of the gene, whereas the 577X allele contains a sequence change that completely prevents the production of functional α-actinin-3 protein. More than a billion people worldwide have two copies of the nonfunctional 577X variant (the XX genotype), resulting in the complete deficiency of α-actinin-3 protein in their skeletal muscle.1
Several studies demonstrated that the frequency of the 577XX genotype is lower in elite sprint and power athletes than in controls, suggesting that α-actinin-3 is required for a power performance.3 4 5 6 7 8
Recently, two studies reported that the loss of α-actinin-3 expression in a knockout mouse model results in a shift in muscle metabolism toward the more efficient aerobic pathway and an increase in intrinsic endurance performance.9 10 However, little is known about the effect of α-actinin-3 deficiency on human endurance performance. The hypothesis of Yang et al3 that α-actinin-3 deficiency may confer some advantage in endurance performance events, based on the case-control study of Australian endurance athletes, has not been supported by the independent studies of elite endurance athletes from different countries.4 11 12 13 14
The aim of the present study was to examine the distribution of ACTN3 R577X genotypes and alleles in Russian endurance athletes and to search for possible associations between the ACTN3 genotype and the rowers’ competition results.
Materials and methods
The University of St Petersburg Ethics Committee approved the study, and written informed consent was obtained from each participant.
Subjects and controls
Four hundred and fifty-six male and female Russian athletes of regional or national competitive standard were recruited from the following endurance sports: biathlon (n = 40; distances, 15–20 km), cross-country skiing (n = 98; distances, 10–50 km), race walking (n = 21; distances, 10–50 km), road cycling (n = 34; distances: ≥50 km), rowing (n = 187, distances: ≥2000 m), swimming (n = 42; distances, 0.8–25 km) and triathlon (n = 34; distances: swimming 1500 m, cycling 40 km, running 10 km). Thirty athletes were classified as “highly elite”, being at least winners of the World Championships, World Cups and Olympic Games; 99 athletes were classified as “elite”, being at least silver or bronze medalists at the World Championships, World Cups and Olympic Games or prize winners at European Championships; 155 athletes were classified as “sub-elite” (participants of international competitions), the others (n = 222) were classified as “average” athletes, being regional competitors with no less than 4 years of experience participating in their sports.
The data (rowing time, s) from the Russian Cup Rowing Tournament (14–15 October, 2006; rowing canal “Don”, Rostov-on-Don) were used to search for possible associations between the ACTN3 genotype and the long-distance rowing performance of 54 highly elite and elite athletes (34 men (19 rowers from double scull teams and 15 rowers from single scull teams) and 20 women (12 rowers from double scull teams and 8 rowers from single scull teams)). The Russian Cup Rowing Tournament is a non-standard long-distance (predominantly aerobic) race competition that covers a distance of approximately 6 km. The official results of the Russian Cup Rowing Tournament 2006 are available at the following website: http://www.rowingru.com.
Controls were 1211 healthy unrelated citizens of St Petersburg, Moscow, Naberezhniye Chelny and Surgut (532 men and 679 women). The athletes and control groups were all Caucasians (predominantly Russians and Tatars), with an equivalent ratio of European and Siberian descent (3:1 in both groups) for more than three generations. Further characteristics are presented in table 1.
ACTN3 genotype distribution of the athletes and controls with sex (frequencies) and age
Genotyping
DNA was extracted from mouthwash samples as previously described.15 Genotyping for the C1743T (R577X) variant was performed by PCR and restriction enzyme digestion. PCR primers were forward CTGTTGCCTGTGGTAAGTGGG and reverse TGGTCACAGTATGCAGGAGGG, generating a fragment of 290 bp. PCR products were digested with BstDEΙ (SibEnzyme, Russia) for 12 h at 60°C and were separated by 8% polyacrylamide gel electrophoresis, stained with ethidium bromide and visualised in UV light.
Statistical analysis
Genotype distribution and allele frequencies between groups of athletes and controls were then compared by χ2 testing using the GraphPad InStat statistical package. Differences between genotype groups for the investigated competition results were assessed using one-way analysis of variance. p Values of p<0.05 were considered statistically significant.
Results
Case-control study
ACTN3 genotype distribution in the control group was in Hardy–Weinberg equilibrium (χ2 = 0.59; df = 2, p = 0.743). Genotype distribution among controls (577RR, 36.5%; 577RX, 49.0%; 577XX, 14.5%) was similar to that observed in several reported groups of Caucasian populations (table 1).2 3 16
The ACTN3 genotype distribution and the 577X allele frequency among the athletes are presented in table 2. Hardy–Weinberg equilibrium calculation showed deviation from the expected frequencies in athletes (χ2 = 14.2; df = 2, p = 0.0008). Genotype distribution in a whole cohort of athletes showed significant differences (p<0.0001) when compared with controls. The frequencies of the ACTN3 577XX genotype (5.7% vs 14.5%; p<0.0001) and 577X allele (33.2% vs 39.0%; p = 0.0025) were significantly lower in athletes compared with controls.
ACTN3 genotype distribution and frequencies of ACTN3 gene 577X allele in Russian endurance athletes.
In considering individual sporting disciplines, biathletes (p = 0.034), cross-country skiers (p = 0.0097), road cyclists (p = 0.01), rowers (p = 0.0003) and triathletes (p = 0.01) had a significantly lower percentage of the ACTN3 577XX genotype compared with controls (14.5%). The frequency of 577X allele was significantly lower only in cross-country skiers and road cyclists compared with controls (table 2).
None of the highly elite athletes had the ACTN3 577XX genotype (p = 0.016, compared with controls). Furthermore, the frequencies of the 577XX genotype were also lower in elite (9.1%), subelite (7.6%; p = 0.056, compared with controls) and average athletes (4.1%; p<0.0001, compared with controls).
We also investigated the association of the ACTN3 R577X polymorphism with athletic status in male and female athletes. ACTN3 genotype distribution in both men (p = 0.0003) and women (p = 0.003) was significantly different compared with male and female controls, respectively. Furthermore, the 577XX genotype was under-represented in both sexes (men, 6.8% vs 16.7%, p<0.0001; women, 3.7% vs 12.7%, p = 0.0004) compared with controls (table 1).
Genotype–phenotype association study
Among the 54 rowers who participated in the Russian Cup Rowing Tournament, we found only three athletes with the ACTN3 577XX genotype. These athletes were involved in the men’s double scull race (n = 19) and showed the slowest rowing times (1402 (10) s; p = 0.016) when compared with athletes with 577RX (1386 (12) s) and 577RR (1339 (11) s) genotypes. No statistically significant differences were found in the competition results of carriers of the 577RR and 577RX genotypes in other rowing groups.
Discussion
This is the first study to demonstrate that the ACTN3 XX genotype is significantly under-represented in Russian endurance-oriented athletes compared with controls and that it limits the potential of athletes to achieve successful results in endurance competitions. The finding of significant deviations from the Hardy–Weinberg equilibrium in the athletes but not in controls in this study is consistent with a true genotype association.17 Although previous studies indicated that the presence of α-actinin-3 in fast-twitch fibres has a beneficial effect on success in sprint/strength events, it seems that an α-actinin-3 deficiency may also negatively influence the power component of sports performance in endurance athletes.
It is well known that the physiological demands of modern endurance events are very high, and endurance-oriented athletes are also required to perform very forceful muscle contractions during the competitively critical phases of the races despite the long duration of these events.18 For instance, despite the long duration of daily stages (∼ 5 h on average), professional cycling has evolved into a power-oriented sport over the past few years, at least as far as the most critical phases of the competitions are concerned.11 Furthermore, the very high speeds and near-maximal intensities at which endurance events are currently performed by top-level runners and skiers probably requires the ability to recruit type II fibres, that is, expressing α-actinin-3 protein.11 With regard to rowing, it is well established that rowers should exhibit excellent isokinetic strength and power. They utilise a unique physiological pattern of race pacing; they begin exertion with a vigorous sprint, which places excessive demands on anaerobic metabolism followed by a severely high aerobic steady state and a fast finish.19 Data also indicate that the rowing times become approximately 0.7 s faster per year.20 Additionally, in most endurance events in which the races begin with a mass start, the strategies to win include covering the distance with the top participants of the race for as long as possible and turning the long-distance fight into an exhausted sprint for the finish.
Therefore, we assume that although α-actinin-3 deficiency is associated with the preponderance of type I (slow-twitch) fibres in untrained human subjects21 and with increased activity of multiple enzymes in the aerobic metabolic pathway of knockout mice,10 such a condition may be considered as a limiting factor in the manifestation of power and strength in endurance events. At least our findings that none of the highly elite endurance-oriented athletes had the ACTN3 577XX genotype and the fact that male rowers with the α-actinin-3 deficiency phenotype showed the slowest rowing time (577RR homozygotes were faster than athletes with 577XX genotype by ∼1 min) support this hypothesis. Despite the possible favourable effect of an α-actinin-3 deficiency on aerobic metabolism, we suppose that Russian endurance athletes with α-actinin-3 in their working muscles can attain a top-level endurance performance not only due to the advantage of generating forceful contractions at high velocity, but also because of the compensatory and additive effect of other genetic variants associated with endurance-related traits.
The possible mechanisms underlying the association of the ACTN3 R577X polymorphism with athletic performance have been discussed in detail in the recent publications.1 9 10
The first published case-control study showed that the frequency of the ACTN3 577XX genotype was higher in Australian endurance athletes (n = 194) compared with controls, although this was only significant in women (n = 72).3 However, the hypothesis that the α-actinin-3 deficiency may confer some advantage in endurance performance events has not been supported by the independent studies of elite Finnish (n = 40), Spanish (n = 102), Ethiopian (n = 76), Kenyan (n = 284) and Italian (n = 42) endurance athletes and Caucasian triathletes (n = 457).4 11 12 13 14 Furthermore, no significant relationships were detected between ACTN3 R577X genotypes and endurance-related traits such as Vo2max in Spanish or Russian endurance athletes.11 22 On the contrary, recently, Gómez-Gallego et al23 have reported that professional road cyclists with the ACTN3 577RR/RX genotypes had significantly higher peak power output and ventilatory threshold (both are considered as endurance phenotypic traits) values than their XX counterparts. The results of the present investigation are not in agreement with the study of Australian female endurance athletes, which may be explained, in part, by using different sample sizes and by differences in the effect of ACTN3 R577X genotypes on the athletic performance of different ethnic groups. Additional studies are needed to clarify this question.
Our study does have limitations. The number of rowers participating in the Russian Cup Rowing Tournament with available DNA was small. As in all such studies, extension to, and replication within other racial groups is proposed. Further, it is worth mentioning that performance in the rowing competition is unlikely to be reducible to a single phenotype trait: motivation, mental toughness, tactical astuteness, team coherence, status of maturity, decision making and other non-physiological factors do also determine success. Therefore, our data showing that ACTN3 R577X polymorphism was associated with the results of the rowing competition should be interpreted with caution.
In conclusion, our data suggest that α-actinin-3 deficiency may negatively influence sports performance in Russian endurance athletes.
References
Footnotes
Competing interests None declared.