Table 1 PCR primers and probes used for genotyping
SNPPrimers (forward/reverse)Probes
rs591058GAGCAGCAACGAGAAATAAATTGGTVIC-CTATTGTTCTCGATTTCT
GCAGACCTGTGTAATGCACATGFAM-ATTGTTCTCAATTTCT
rs679620TGTAAGAGTGACCTAAAAACTATACTTATTCTGTTAGAVIC-AACTACTACGACCTCAAAAA
CCACTGTCCTTTCTCCTAACAAACTFAM-AACTACTACGACCTCGAAAA
rs650108CATCATTATCAGGTAGAGGTGACAAGTVIC-CAAGGGCTACTTCTAAC
CTCATTGTGTGTTTGTTTTGTCTTCCTFAM-AAGGGCTACCTCTAAC
  • Primer and probe sets were incorporated into a PCR mastermix and used as described in materials and methods.

  • SNP, single nucleotide polymorphism.